anonymous
  • anonymous
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Biology
  • Stacey Warren - Expert brainly.com
Hey! We 've verified this expert answer for you, click below to unlock the details :)
SOLVED
At vero eos et accusamus et iusto odio dignissimos ducimus qui blanditiis praesentium voluptatum deleniti atque corrupti quos dolores et quas molestias excepturi sint occaecati cupiditate non provident, similique sunt in culpa qui officia deserunt mollitia animi, id est laborum et dolorum fuga. Et harum quidem rerum facilis est et expedita distinctio. Nam libero tempore, cum soluta nobis est eligendi optio cumque nihil impedit quo minus id quod maxime placeat facere possimus, omnis voluptas assumenda est, omnis dolor repellendus. Itaque earum rerum hic tenetur a sapiente delectus, ut aut reiciendis voluptatibus maiores alias consequatur aut perferendis doloribus asperiores repellat.
chestercat
  • chestercat
I got my questions answered at brainly.com in under 10 minutes. Go to brainly.com now for free help!
anonymous
  • anonymous
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
blues
  • blues
Yes, correct!
blues
  • blues
Thanks for your patience.

Looking for something else?

Not the answer you are looking for? Search for more explanations.

More answers

anonymous
  • anonymous
Thanks for reviewing for me

Looking for something else?

Not the answer you are looking for? Search for more explanations.