  • anonymous
Which of the following would be the correct polypeptide sequence for the mRNA fragmet: GGCCCUAUGGGACCAAGCGGGCCGAGA? gly - pro - gln - arg - lys - pro - met - gly - arg gly - pro - met - gly - ser - pro - arg - gly - arg gly - pro - met - gly- pro - ser - gly - pro - arg gly - pro - met - gly- ser - pro - gly - pro - arg
  • Stacey Warren - Expert
Hey! We 've verified this expert answer for you, click below to unlock the details :)
At vero eos et accusamus et iusto odio dignissimos ducimus qui blanditiis praesentium voluptatum deleniti atque corrupti quos dolores et quas molestias excepturi sint occaecati cupiditate non provident, similique sunt in culpa qui officia deserunt mollitia animi, id est laborum et dolorum fuga. Et harum quidem rerum facilis est et expedita distinctio. Nam libero tempore, cum soluta nobis est eligendi optio cumque nihil impedit quo minus id quod maxime placeat facere possimus, omnis voluptas assumenda est, omnis dolor repellendus. Itaque earum rerum hic tenetur a sapiente delectus, ut aut reiciendis voluptatibus maiores alias consequatur aut perferendis doloribus asperiores repellat.
  • katieb
I got my questions answered at in under 10 minutes. Go to now for free help!
  • barreraA
this might help you @MathmaticalMolly
  • anonymous
i have no idea how to though
  • aaronq
Break it up into codons (sets of 3) GGC CCU AUG GGA CCA AGC GGG CCG AGA then use a codon table just match them up

Looking for something else?

Not the answer you are looking for? Search for more explanations.

More answers

  • anonymous
gly - pro - met - gly- pro - ser - gly - pro - arg ?
  • aaronq
  • anonymous
thx so much!!!
  • aaronq
no problem

Looking for something else?

Not the answer you are looking for? Search for more explanations.