A community for students.

Here's the question you clicked on:

55 members online
  • 0 replying
  • 0 viewing

anonymous

  • one year ago

Which of the following would be the correct polypeptide sequence for the mRNA fragmet: GGCCCUAUGGGACCAAGCGGGCCGAGA? gly - pro - gln - arg - lys - pro - met - gly - arg gly - pro - met - gly - ser - pro - arg - gly - arg gly - pro - met - gly- pro - ser - gly - pro - arg gly - pro - met - gly- ser - pro - gly - pro - arg

  • This Question is Closed
  1. barreraA
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 0

    this might help you @MathmaticalMolly https://answers.yahoo.com/question/index?qid=20151007081655AA6swBE

  2. anonymous
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 0

    i have no idea how to though

  3. aaronq
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 1

    Break it up into codons (sets of 3) GGC CCU AUG GGA CCA AGC GGG CCG AGA then use a codon table https://en.wikipedia.org/wiki/DNA_codon_table just match them up

  4. anonymous
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 0

    gly - pro - met - gly- pro - ser - gly - pro - arg ?

  5. aaronq
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 1

    yep

  6. anonymous
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 0

    thx so much!!!

  7. aaronq
    • one year ago
    Best Response
    You've already chosen the best response.
    Medals 1

    no problem

  8. Not the answer you are looking for?
    Search for more explanations.

    • Attachments:

Ask your own question

Sign Up
Find more explanations on OpenStudy
Privacy Policy

Your question is ready. Sign up for free to start getting answers.

spraguer (Moderator)
5 → View Detailed Profile

is replying to Can someone tell me what button the professor is hitting...

23

  • Teamwork 19 Teammate
  • Problem Solving 19 Hero
  • You have blocked this person.
  • ✔ You're a fan Checking fan status...

Thanks for being so helpful in mathematics. If you are getting quality help, make sure you spread the word about OpenStudy.

This is the testimonial you wrote.
You haven't written a testimonial for Owlfred.